﻿discoSnp
an efficient tool for discovering SNPs without a reference genome
v1.2.2
User's guide – May 2014

contact: pierre.peterlongo@inria.fr
CeCILL License
Copyright INRIA

This software is a computer program whose purpose is to find all the similar reads between two set of NGS reads. It also provide a similarity score between the two samples.

This software is governed by the CeCILL license under French law and abiding by the rules of distribution of free software.  You can  use, modify and/ or redistribute the software under the terms of the CeCILL license as circulated by CEA, CNRS and INRIA at the following URL "http://www.cecill.info".

As a counterpart to the access to the source code and  rights to copy, modify and redistribute granted by the license, users are provided only with a limited warranty  and the software's author,  the holder of the economic rights,  and the successive licensors  have only  limited liability.

In this respect, the user's attention is drawn to the risks associated with loading,  using,  modifying and/or developing or reproducing the software by the user in light of its specific status of free software, that may mean  that it is complicated to manipulate,  and  that  also therefore means  that it is reserved for developers  and  experienced professionals having in-depth computer knowledge. Users are therefore encouraged to load and test the software's suitability as regards their requirements in conditions enabling the security of their systems and/or data to be ensured and,  more generally, to use and operate it in the same conditions as regards security.

The fact that you are presently reading this means that you have had knowledge of the CeCILL license and that you accept its terms.

Publication
Publication is in preparation
IN/OUT in a few words
Software discoSnp is designed for extracting Single Nucleotide Polymorphism (SNP) from raw set(s) of reads obtained with Next Generation Sequencers (NGS). 
The number of input read sets is not constrained, it can be one, two, or more. No other data such as a reference genome or annotations are needed.
Note that this tool is specially designed to use only a limited amount of memory (3 billions reads of size 100 can be treated with less that 6GB memory).
The software is composed of two modules. The first module, kissnp2, detects SNPs from read sets. The second module, kissreads, enhances the kissnp2 results by computing per read set  and for each found SNP i/ its mean read coverage and ii/ the average (phred) quality of reads generating the polymorphism. 

Download
From discoSnp web page – http://colibread.inria.fr/discosnp/ . Please read and accept the CeCILL license before downloading.
Installation
Unzip the downloaded package :
 	# unzip discoSnp_versionnumber.zip
Get into the newly created discoSnp directory:
	# cd discoSnp
Compile the two modules (kissnp and kissreads) with the single command:
 	# ./compile_kissnp_kissreads.sh k_value
Note about the k value: 
	Replace k_value by the value of the kmer that you wish to use. 
	No need to recompile for any values below or equal to 31
	No need to recompile for any values in [32,63]
	No need to recompile for any values in [64,127]
	...
	By default, k=31 (value used both for compiling and in runtime).
	
If you wish to recompile (for instance for changing the k value from any value below or equal to 31 to any value bigger or equal to 32) first clear the previously compiled executables:
	# ./clear_kissnp_kissreads.sh 

This installation process should generate the “tool” directory containing the two executables : kissnp2 and  kissreads. 

Running discoSnp
Modify the run_discoSnp.sh file header or use it with parameters (see below). You will provide the following information:
read_sets="readref.fasta   readsnp.fastq.gz”: localization of the read files. Note that these files may be in fastq, or fasta, gzipped or not.
prefix="test_ref" : all temp and final files will be written will start with this prefix
k=31:  size of kmers
b=0 branching filtering approach. This parameters influances the precision recall. 
0: SNPs for wich any of the two paths is branching are discarted (high precision, lowers the recal in complex genomes). Default value
1: (smart branching) forbid SNPs for wich the two paths are branching (e.g. the two paths can be created either with a 'A' or a 'C' at the same position 
2: No limitation on branching (lowers the precision, high recall)"
c=4: minimal kmer coverage
d=1: max number of errors per read (used by kissreads only)
g=10000000 : estimated genome size. Used only to control kissnp2 memory usage. e.g. 3 billion (3000000000) uses 4Gb of RAM.
PATH_RS="./tools/": where the two executables are. If you decide to copy them in a directory member of the PATH environment variable (e.g. /usb/local/bin), just set PATH_RS=””
Additionally you may change some kissnp2 / kissreads options. In this case you may change the two corresponding lines in the run_discoSnp.sh file. To know the possible options, type ./tools/kissnp2 and/or ./tools/kissreads without options. Note that usually, changing these options is not necessary. 
Note that you may also specify the parameters in command line fashion. For instance:
# ./run_discoSnp.sh -r "data_sample/reads_sequence1.fasta   data_sample/reads_sequence2.fasta.gz" -p test_ref -k 31 -c 4 -d 1 -g 10000000 -b 2
Note that command line parameters have the higher priority than those hard coded in the .sh file. 
Just type “./run_discoSnp.sh -h” to obtain the list of parameters.

Sample example:
By default, if you just type:
 # ./run_discoSnp.sh 
discoSnp will be run on a toy example of reads contained in the data_sample directory. Among others this will generate the file test_ref_k_31_c_4_coherent.fa containing the found SNPs, ranked with respect to their coverages.
Output
Final results are in prefix_coherent_k_kval_c_cval.fa file. This is a simple fasta file composed of a succession of pairs of sequences. Each pair corresponds to a SNP. Let's look at an example :
>SNP_higher_path_2|high|left_unitig_length_472|right_unitig_length_261|left_contig_length_472|right_contig_length_378|C1_8|C2_120|rank_0.88900
ttgcggataccgttgagacatcttataagtagacgcaatgcggaatcttatagaatcgcccgatagcgttgtgttggtggacacggctgattaccctctcacccgcgctattagcttccataccacctgcggccatccattaagatccgctgctcctcacgaaaaaagaattaataagaagtcccgtaacatgcggatttggtagtcgttatagacaactttactggggcgaactaaaacgcttgtggacagaattttggcagtggcaattaatctctaatgatgtgatattagggtctaaaatgtaagaattcggtgagttagattggacaaggggatccgaagatgttttggcgcagttagtcacagggggagcccctgcctacaaaaagcgcttactgttgactgtctagggatacagcgaaagcggcagtcgttgaagcaaaagtgatatgtgcgacactgcatctagGCAGCGCAACAACGCAACAGCTCGAGGTGTACTTCGCAGAGAAACCGCACGTCCAGTTCTAacactctcatatgtgctcgtcgtttatgctttcggcgtgaaaactggtgcgccggtgtctggagaccatccttcttgcgtatgactccaaggacagccatcacggtttgtgggttcactgggactgtcacgcttaaccggacggaactcgagaaggcatacgactggtcgtaagaccgctctgatccgacaccaccataacgcggcactcatgattatcatcacttttttagtccctattacagagctgccgggtggatgactctctaccgcgctctgtggaagtgcacttgatcgttttgctgtagaaaaaacttaataaacagaatgccgatgaaggcactactgtactaatagggccgggctacatgttaactac
>SNP_lower_path_2|high|left_unitig_length_472|right_unitig_length_261|left_contig_length_472|right_contig_length_378|C1_118|C2_6|rank_0.88900
ttgcggataccgttgagacatcttataagtagacgcaatgcggaatcttatagaatcgcccgatagcgttgtgttggtggacacggctgattaccctctcacccgcgctattagcttccataccacctgcggccatccattaagatccgctgctcctcacgaaaaaagaattaataagaagtcccgtaacatgcggatttggtagtcgttatagacaactttactggggcgaactaaaacgcttgtggacagaattttggcagtggcaattaatctctaatgatgtgatattagggtctaaaatgtaagaattcggtgagttagattggacaaggggatccgaagatgttttggcgcagttagtcacagggggagcccctgcctacaaaaagcgcttactgttgactgtctagggatacagcgaaagcggcagtcgttgaagcaaaagtgatatgtgcgacactgcatctagGCAGCGCAACAACGCAACAGCTCGAGGTGTTCTTCGCAGAGAAACCGCACGTCCAGTTCTAacactctcatatgtgctcgtcgtttatgctttcggcgtgaaaactggtgcgccggtgtctggagaccatccttcttgcgtatgactccaaggacagccatcacggtttgtgggttcactgggactgtcacgcttaaccggacggaactcgagaaggcatacgactggtcgtaagaccgctctgatccgacaccaccataacgcggcactcatgattatcatcacttttttagtccctattacagagctgccgggtggatgactctctaccgcgctctgtggaagtgcacttgatcgttttgctgtagaaaaaacttaataaacagaatgccgatgaaggcactactgtactaatagggccgggctacatgttaactac
In this example a SNP A/T is found (underlined here). The central sequence of length 2k-1 (here 2*31-1=61) is seen in upper case, while the two (left and right) extensions are seen in lower case. 
The comments are formatted as follow :
	>SNP_higher/lower_path_id|high/low|left_unitig_length_int|right_unitigtig_length_int|left_contig_length_int|right_contig_length_int|C1_int|C2_int|[Q1_int|Q2_int|]rank_float
higher/lower: one of the two alleles 
id: id of the SNP: each SNP (couple of sequences) has a unique id, here 3.
high/low: sequence complexity. If the sequece if of low complexity (e.g. ATATATATATATATAT) this variable would be low
left_unitig_length: size of the full left extension. Here 472
right_unitig_length: size of the right extension. Here 261
left_contig_length: size of the full left extension. Here 472
right_contig_length: size of the right extension. Here 378
C1: number of reads mapping the central upper case sequence from the first read set
C2: number of reads mapping the central upper case sequence from the second read set
C3 [if input data were at least 3 read sets]:  number of reads mapping the central upper case sequence from the third read set
C4, C5, ...
Q1 [if reads were given in fastq]: average phred quality of the central nucleotide (here A or T) from the mapped reads from the first read set.
Q2 [if reads were given in fastq]: average phred quality of the central nucleotide (here A or T) from the mapped reads from the second read set.
Q3 [if the data were at least 3 fastq read sets]: average phred quality of the central nucleotide (here A or T) from the mapped reads from the third read set.
Q4, Q5, …
rank: ranks the predictions according to their read coverage in each condition favoring SNPs that are discriminant between conditions (Phi coefficient) (see publication)
Extensions: differences between unitig and contigs (from version 2.1.1.3)
By default in the pipeline, the found SNPs (of length 2k-1) are extended using a contiger. The output contains such contigs and their lengths are shown in the header (left_contig_length and right_contig_length). Moreover, a contig may hide some small polymorphism such as substitutions and/or indels. The output also proposes the length of the longuest extension not containing any such polymorphism. These extensions are called unitigs (defined as « A uniquely assembleable subset of overlapping fragments »).
Output Analyze
From a fasta format to a csv format: If you wish to analyze the results in a tabulated format: 
# python output_analyses/discoSnp_to_csv.py discoSnp_output.fa 
will output a .csv tabulated file containing on each line the content of 4 lines of the .fa, replacing the '|' character by spaces and removing the CX_
example with previously used SNP example:
>SNP_higher_path_3 high left_contig_length_86 right_contig_length_52 78 5 rank_0.89839 tctctaccgcgctctgtggaagtgcacttgatcgttttgctgtagaaaaaacttaataaacagaatgccgatgaaggcactactgtACTAATAGGGCCGGGCTACATGTTAACTACAAGGCTATAACCTATTGATGACCCGGTCCATacataacttggtatcgtgcatgtagcgttcaagggctatagcaattccgacg >SNP_lower_path_3 high left_contig_length_86 right_contig_length_52 4 91 rank_0.89839 tctctaccgcgctctgtggaagtgcacttgatcgttttgctgtagaaaaaacttaataaacagaatgccgatgaaggcactactgtACTAATAGGGCCGGGCTACATGTTAACTACTAGGCTATAACCTATTGATGACCCGGTCCATacataacttggtatcgtgcatgtagcgttcaagggctatagcaattccgacg
Genotyping the results: If you wish to genotype your results:
#python output_analyses/discoSnp_to_genotypes.py discoSnp_output.fa threshold_value
will output a file containing on each line the “genotypes” of a SNP.  For each input data set it indicates if the SNP is:
heterozygous ALT1 path (coverage ALT1 >= threshold and ALT2 < threshold): 1
heterozygous ALT2 path (coverage ALT1 < threshold and ALT2 >= threshold): -1
homozygous (coverage ALT1 >= threshold and ALT2 >= threshold): 2
absent (coverage ALT1 < threshold and ALT2 < threshold): 0
then it outputs the central sequence of length 2k-1 replacing the central position by ALT1/ALT2
example with previously used SNP example and threshold 20:
GENOTYPES_SNP_3_THRESHOLD_20 1 -1 TACTAATAGGGCCGGGCTACATGTTAACTACA/TAGGCTATAACCTATTGATGACCCGGTCCATA

Misc.
Running discoSnp generates a set of files used for indexing the reads. This are all files with suffixes: 
.solid_kmers_binary, .reads_binary, .false_positive_kmers, .debloom2, and .debloom
With large read sets, these files may consume disk space. You may remove all of them after the discoSnp pipeline is over:
	# rm -f *.solid_kmers_binary *.reads_binary *.false_positive_kmers *.debloom2  *.debloom
Note that if you wish to re-run the pipeline without changing option among k, c and C (in kissnp2_exe) it is smart not to remove these files as they will be recomputed.
